University of Georgia Invitational — Protein Modeling

Protein Modeling · Division C · University of Georgia Invitational · 2021

40 questions · 170 points · 50 min

Original test source

Question 1

5 pts

Describe the function of a Cas9 nickase and the rationale for why it may be a desirable gene editing CRISPR tool.

Question 2

4 pts

Describe how the Cas9 protein or variants thereof have been used as an epigenetic gene modifying tool

Question 3

4 pts

The following figure is a Cas9 variation protocol called CLASP, or Cas9 locus-associated proteome, which involves directing a dead Cas9 protein with a FLAG tag to a DNA site of interest, cross-linking DNA/Cas9, and purifying Cas9 for downstream analysis. Speculate as to what the purpose of this assay is (what information does it tell you?)

Question 4

2 pts

What bond type is the greatest gross determinant of protein folding (not per bond, but total for a protein)

Question 5

4 pts

You have an ionic bond between two amino acids. One of them is a lysine. Name the most probable amino acids that play a role in this interaction as determined by chemical group (answer giving amino acid names).

Question 6

5 pts

What bond type commonly found in various proteins has the strongest individual bond strength, and what type of bond is it (ionic, covalent, VDW, etc?

Question 7

4 pts

What is the primary difference in the sugar structure of DNA and RNA?

Question 8

6 pts

How does the difference mentioned in question 7 affect the stability of the corresponding molecule mechanistically?

Question 9

6 pts

Describe the process of CRISPR adaptation, and explain why it is important

Question 10

4 pts

What is the difference between CRISPR primed adaptation and CRISPR naive adaptation? Which of these leads to increased efficiency of spacer acquisition?

Question 11

6 pts

Cas1 and Cas2 integration complex is essential for CRISPR adaptation. In E. Coli, additional proteins known as the integration host factor (IHF) is also required for CRISPR adaptation to occur by bending a region of DNA known as the leader sequence. Hypothesize two reasons as to why IHF is essential for integration of DNA

Question 12

5 pts

Describe how the FokI nuclease has been used to engineer Cas9 proteins for lower off target specificity.

Question 13

8 pts

Use the following experimental procedure below to answer questions 13-15 CRISPR adaptation assays are a mechanism of testing whether or not integration of foreign, viral DNA has taken place. It consists of utilizing a forward primer on the leader sequence of the bacterial host genome and a reverse primer on the first known repeat, running PCR of that region to amplify the DNA, and then running gel electrophoresis on these samples. Below are the results of a gel electrophoresis of these adaptation essays for four samples of the hyperthermophilic archaeon Pyroccocus furiosus. A 100 base pair ladder is shown on the left of the gel for reference of product sizes Sample Number: 1 2 3 4

Question 14

4 pts

Which samples have viral DNA integrated into the host genome? How do you know?

Question 15

6 pts

Suppose sample one has a third band located at about 300-350 base pair region of the gel electrophoresis. Hypothesize what this might mean for sample 1.

Question 16

5 pts

Describe why it might be beneficial to either identify smaller Cas9 variants or reduce the side of Cas9 transgenes in the context of gene delivery vectors

Question 17

2 pts

Which type of bond is the most important for determining secondary structures of proteins?

Question 18

2 pts

Which stage of protein structure would dimerization be considered a part of?

Question 19

4 pts

Which of the following is not a DNA binding domain motif?

Question 20

4 pts

Which of the following could be a potential Protospacer adjacent motif (PAM) sequence, specifically involving the spCas9 protein(most common isolate)?

Question 21

3 pts

If the pH of a solution is 8.5 and the pKa of an amino acid is 7.3, is it likely protonated, neutral, or deprotonated? Assume that it can be readily be protonated/deprotonated and that the amino acid is free in solution (local environment doesn’t matter)

Question 22

6 pts

A recently developed dCas9 engineering tool termed CRISPR-X was made to recruit AID, a deaminase, to specific sites. What would such a tool do, and what could be its purpose?

Question 23

10 pts

The CRISPR defense is delineated into three steps or phases. What are they? Give a 1-2 sentence explanation for each step.

Question 24

2 pts

The introduction of an extra sulfur-containing amino acid to an existing protein would mostly likely directly change which level of protein structure?

Question 25

2 pts

Which of the following is present in RNA but not in DNA?

Question 26

4 pts

Protein folding

A. begins when newly synthesized proteins are released from RNA polymerase during transcription.B. is a process in which defective proteins are degraded and removed from the cellC. is a result of electrostatic interactions between hydrophobic amino acidsD. requires entry of the protein into the endoplasmic reticulumE. is a process in which basic principles of chemistry drive a specific sequence of amino acids into a compact 3D shape

Question 27

4 pts · select all that apply

Name two types of non-covalent interactions that stabilize DNA structure and briefly describe them in a sentence

A. Hydrogen bonds - are an attraction between a partially positive hydrogen atom that is covalently bound to a highly electronegative atom on one side and near another partially negative atom (e.g., oxygen, nitrogen, sulfur, or fluorine atom). (2 points)B. Stacking interactions - are formed as a result of interactions between π-orbitals of a molecular system. (2 points)

Question 28

3 pts

What, if any, charge does DNA have, and how does this enable it to interact with histone tails?

Question 29

4 pts

The location of an amino acid in a folded protein is primarily determined by

A. The charge of the side groupB. The size of the side groupC. The hydrophobicity of the side groupD. The overall charge of the protein

Question 30

6 pts

What is the sentence in the following sequence: ATTCACGAGGCAAGGACTTCCTGCATAGAAAACTGTGAA

Question 31

4 pts

What are the four groups bonded to carbon in an amino acid?

Question 32

2 pts

Alpha helices are generally oriented in a

A. Right-hand spiralB. Left-hand spiralC. Both directions are equally likely

Question 33

2 pts

A parallel beta sheet includes

A. Peptide strands running in the same directionB. Peptide strands running in opposite directions

Question 34

2 pts

A beta turn typically involves this many amino acids.

A. 3B. 4C. 5D. 6

Question 35

6 pts

List the uses of CRISPR-Cas9 technology in all its forms.

Question 36

8 pts

TIE BREAKER: Compare WT CRISPR/Cas9 and Zinc Finger nucleases and Talens in the following areas (a) Type of Cut (b) Method for altering target (c) Specificity (which is higher?) (d) Expenses

Question 37

4 pts

TIE BREAKER: In Cas9, where is the duplex that is formed by sgRNA and the target DNA located?

Question 38

4 pts

TIE BREAKER: The anti-CRISPR protein

A. provides bacteria an active counter defenseB. provides phages an active counter defenseC. interferes with phage infectionD. interferes with bacterial infectionE. results from mutated CRISPR proteins

Question 39

3 pts

TIE BREAKER: During translation, which end of the protein is synthesized first?

Question 40

1 pt

TIE BREAKER: Which of the following amino acids feature positively a charged side chain at physiological pH? I. Lysine II. Aspartic Acid III. Methionine IV. Threonine

0/40 answered