Question 1
2 ptsWhat is the mode of inheritance for Huntington’s Disease? Do not exclude the possibility of incomplete penetrance.
UT Invitational — Heredity
Heredity · Division B · UT Invitational · 2026
52 questions · 113 points · 50 min· 5 questions from the original omitted
Original test sourceYou will have 50 minutes to complete this exam - do not begin until instructed to do so! All answers must be indicated on your answer document. DO NOT WRITE ON THIS EXAM! Teams that write on the exam will have 10 points docked from their overall score. Point values are indicated for all questions & tiebreakers are indicated in test booklets. The maximum number of obtainable points on this exam is 110 points. Tiebreakers will be broken using the higher score in the tiebreaker section. If the tie still holds, then the higher score in section 1, 5, 3, 4, and then 2 will be used in that order. You may take apart the test to split the work, but make sure to staple it back together at the end of the event.
Section 1: Mendelian Genetics
Use the following pedigree to answer questions #1-4: The pedigree shows a family with a history of Huntington's disease. The allele associated with Huntington’s Disease is very rare, and it is unlikely for individuals marrying into the family to carry this allele.
Question 2
2 ptsOnly 40% of individuals with the genotype for Hungtington’s Disease show symptoms by age 40. If individual III-4 is heterozygous at the loci for Huntington’s Disease, what genotypes could individual IV-3 be?
Question 3
3 ptsIf individual IV-3 is already past the age of 40, what is the probability that he has the genotype for Huntington’s Disease?
Question 4
3 ptsIndividual IV-3 is having a child with an unaffected female. What is the probability that they have a child with Huntington’s Disease?
Use the following pedigree to answer questions #5-8:
Question 5
2 ptsShaded individuals in the above pedigree have red hair. Assuming that red hair is a completely penetrant trait and is controlled by one gene, what is the mode of inheritance?
Question 6
2 ptsWhat is the probability that individual IV-3 has red hair? Show work.
Question 7
2 ptsWhat is the probability that individual IV-4 has red hair? Show work.
Question 8
4 ptsIf individual IV-3 has a child with an unaffected woman who is heterozygous, what is the probability that their child will be normal? Show work.
Use the following scenario to answer questions #9-11: In magical beanstalks, a functional, wild-type allele for both gene A and gene B results in a purple color. The wild-type allele is dominant. When there is a mutation in both gene A and gene B, the beanstalks are white. If the beanstalk only has the functional A allele, they are red, and if they only have the functional B allele, they are blue.
Question 9
2 ptsWrite out a cross between a true-breeding red beanstalk and true-breeding blue bean stalk.
Question 10
2 ptsWhat phenotype would you expect the F1 ratio to be, and why?
Question 11
4 ptsWrite out the F2 phenotypic ratio if you cross two F1 beanstalks.
Use the following scenario to answer questions #12-15: A mutation on the DMD gene on the X-chromosome results in muscular dystrophy if an individual is homozygous or hemizygous for the mutant DMD allele. Suppose an unaffected female (whose father and sister has muscular dystrophy and whose mother is unaffected) has a child with an unaffected male.
Question 12
2 ptsWhat is the probability that the unaffected female is a carrier for the DMD mutation?
Question 13
2 ptsWhat is the probability that they have a son with muscular dystrophy?
Question 14
2 ptsWhat is the probability that they have a normal son?
Question 15
2 ptsWhat is the probability they have an affected daughter? Explain why.
Use the following scenario to answer questions #16-17: A dominant mutation in the hair gene in gnomes causes spiky, short hair, while the wild-type allele encodes long, smooth hair.
Question 16
2 ptsBeing homozygous for the spiky, short hair allele results in lethality. If you cross two gnomes with spiky, short hair, what phenotypic ratio would you expect to see?
Question 17
2 ptsA gnome with spiky, short hair is married to a gnome with long, smooth hair. If they have 90 children, how many of their offspring will have long, smooth hair? Show work.
Section 2: Mitosis and Meiosis
For questions #18-20, answer whether the following scenario happens in mitosis, meiosis I, and/or meiosis II. Put none if it does not happen in any of the three. (2 points each)
Question 18
2 ptsA bivalent structure is formed from the chromosomes during prophase.
Question 19
2 ptsSister chromatids of the same chromosome are separated at anaphase into separate daughter cells.
Question 20
2 ptsAPC/C targets securin for degradation, and separase is now free to cleave cohesin.
Use the following karyotype corresponds to an individual with Klinefelter’s syndrome to answer questions 21 and 22.
Question 21
2 ptsX-inactivation refers to a process in which all but one X chromosome are randomly chosen to condense into a transcriptionally silent Barr body. How many Barr bodies will this individual with Klinefelter’s syndrome have?
Question 22
2 ptsSuppose that this individual with Klinefelter’s syndrome was the result of nondisjunction in their father’s gametes. X chromosome inactivation is caused by transcription of the XIST gene. If the promoter of the XIST gene has a mutation that prevents binding of RNA polymerase on the paternal X chromosome, which chromosome in this individual would become a Barr body and why?
Section 3: Molecular Biology of DNA
Question 23
2 ptsIn the nucleus, DNA is wrapped around proteins called histones. Histone tails can be modified in different ways. Deposition of an acetyl group on lysine 9 of histone 3 would deposit a ____ charge, leading to ____ of the DNA.
Question 24
2 ptsThe region of DNA containing the centromeres is known to be ____.
Question 27
2 ptsMeghna is looking at a yeast cell that has a defect in DNA replication. If the yeast cell’s DNA can be separated but does not remain open long enough for it to be used as a template. Which of the following is the most likely to be defective in this situation?
Question 28
2 ptsSuppose that Meghna finds another yeast cell that contains a mutation in the Wee1, which usually inhibits cell cycle progression. She would expect the G2 phase to be ____, and the cell size to be ____.
Question 29
2 ptsWhat happens to DNA polymerases that are finished synthesizing their Okazaki fragment on the leggings strand?
Question 30
2 ptsTrue or False: DNA polymerase also copies DNA methylation marks from the template strand to the daughter strand.
Question 31
2 ptsAfter synthesizing the lagging strand, there are regions at the end that are left with single-strand overhangs due to the removal of the RNA primers and DNA polymerase’s inability to synthesize on an empty template. These are referred to as the ____.
Question 32
2 ptsYou would expect detect telomerase activity in all the following cell types EXCEPT:
Section 4: Gene and Protein Relationship
Use the following scenario to answer questions #33-35: Natasha wants to figure out the role of a random sequence of nucleotides that she has. She inputs this sequence (sequence #1) in front of the GFP coding sequence within a plasmid and transform bacteria with this new plasmid. Suppose sequence #1 and #2 are evolutionarily conserved in both bacteria and fruit flies.
Question 33
2 ptsIf this strand of bacteria does not normally express GFP and now expresses GFP when transformed with this plasmid, propose a role for Natasha’s sequence of nucleotides.
Question 34
2 ptsShe then finds another sequence of nucleotides (sequence #2) and places it in front of sequence #1 + GFP coding sequence. She transfects some fruit fly embryos with this new plasmid construct and sees that the adult flies have eyes that express GFP. Propose a role for sequence #2.
Question 35
2 ptsIf Natasha were to just take sequence #2 and the GFP coding sequence and transform bacteria with a plasmid containing those two sequences, would she expect to see GFP expression in these bacteria? Why or why not?
Question 36
2 ptsWhich of the following basal transcription factors recognizes the TATA box?
Question 37
2 ptsWhich of the following basal transcription factors has helicase activity?
Question 38
2 ptsAmber discovers a small molecule that binds to TFIIH and inhibits its kinase activity. The kinase activity of TFIIH allows it to phosphorylate the carboxy-terminal domain of RNA polymerase. Which step of transcription does this small molecule block?
Question 39
2 ptsTrue or False: Two different tRNAs are used for the initial methionine and the internal methionines during translation.
Question 40
2 ptsThe chemical chloramphenicol blocks peptidyl transferase activity. Which of the following steps of translation does chloramphenicol inhibit?
Question 41
2 ptsPuromycin is a drug that resembles the tRNA molecule when it has tyrosine attached. However, when it is added to a growing amino acid chain, it stops translation. If you have the following amino acid sequence, what sequence would you get if puromycin is added? Tyr is the shortened three letter notation for tyrosine.
Met - Phe - Phe - Lys - Arg - Tyr - Ser - Lys
Question 42
2 pts · select all that applyWhich of the following steps of protein synthesis require energy? Select all that apply.
Section 5: Technology and Techniques
Use the following scenario to answer questions #43-47: Alia is trying to determine the role of the Gata6 during mammalian development. To do so, she designs a gRNA and CRISPR-Cas9 plasmid to create a double strand break in the third exon of the Gata6 gene in mouse embryonic stem cells (mESCs).
Question 43
2 ptsThe sequence below shows a subsection of exon 3. The part in bold was the region targeted by CRISPR. Design a 10-nucleotide forward and reverse primer that would amplify this region and result in a PCR product of at least 50 bp (hint: there are 52 bp in this sequence).
5’--tccgagagccgcgagtgcgtg aactgcgg ctccatccagacgccgctgtggc—3’ 3’--aggctctcggcgctcacgcac ttgacgcc gaggtaggtctgcggcgacaccg–5’
Question 46
3 ptsWould Alia be able to detect the 1 base pair insertion using gel electrophoresis? If yes, explain why. If not, explain why and propose an alternative method to detect the mutation or knock out.
Question 47
2 ptsWhen Alia runs the gel, she sees a smear at the bottom of the gel and no bands in either lane. However, the ladder was present and ran perfectly. What is one possible explanation for this result, and how could she fix this?
Use the following scenario to answer questions #48-52: Friedreich ataxia is a genetic condition that results when the sequence “GAA” is repeated more than 66 times in intron 1 of the FDRA gene. The mutant allele is recessive to the wild-type allele. Aishwarya is a genetic counselor, and two parents who are carriers for Friedreich ataxia want to determine whether their fetus has the trait. She amplifies the Friedreich ataxia locus and gets the following gel.
Question 48
2 ptsDoes the fetus have Friedreich ataxia?
Question 49
2 ptsWhat is the probability that their next child has Friedreich ataxia?
Question 50
2 ptsIf the parents have another child, what is the probability that they will have a normal child?
Question 51
2 ptsSuppose the father is actually not a carrier but is still unaffected, does the fetus have Friedreich ataxia?
Question 52
2 ptsSingle-nucleotide polymorphisms (SNPs) are single-base pair changes. Suppose Aishwarya gets visited by a couple who are both carriers for sickle cell disease. Sickle cell disease is caused by a single A-to-T base pair change in the HBB gene. Would she be able to use the same strategy to determine whether their fetus has sickle cell disease? Why or why not?
Section 6: Tiebreakers
Question 53
3 ptsExplain how changes in a single base of a gene can cause a truncated protein. Answer in 2-3 sentences.
Question 54
3 ptsExplain where in the gene body would mutations have the most effect on protein structure or function. Answer in 1-2 sentences.
Question 55
2 ptsTrue or False: DNA ligase is needed in a PCR reaction. If false, explain why or why not.
Question 56
2 ptsTrue or False: If you are trying to amplify a 50 base pair sequence of DNA, it will take two PCR cycles to obtain a PCR product of 50 base pairs. If false, explain why or why not.